Lab Reagents
Human Elisa Laboratories manufactures the human flrt3 elisa reagents distributed by Genprice. The Human Flrt3 Elisa reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Human elisa. Other Human products are available in stock. Specificity: Human Category: Flrt3 Group: Elisa
Elisa information
Human FLRT3 shRNA Plasmid |
20-abx958455 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FLRT3 Recombinant Protein (Human) |
RP012355 |
ABM |
100 ug |
Ask for price |
FLRT3 Polyclonal Antibody |
ES10919-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against FLRT3 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FLRT3 Polyclonal Antibody |
ES10919-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against FLRT3 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FLRT3 Polyclonal Antibody |
ABP58573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human FLRT3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FLRT3 from Human, Rat. This FLRT3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT3 protein |
FLRT3 Polyclonal Antibody |
ABP58573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human FLRT3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FLRT3 from Human, Rat. This FLRT3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT3 protein |
FLRT3 Polyclonal Antibody |
ABP58573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FLRT3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FLRT3 from Human, Rat. This FLRT3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT3 protein |
FLRT3 cloning plasmid |
CSB-CL882162HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1950
- Sequence: atgatcagcgcagcctggagcatcttcctcatcgggactaaaattgggctgttccttcaagtagcacctctatcagttatggctaaatcctgtccatctgtgtgtcgctgcgatgcgggtttcatttactgtaatgatcgctttctgacatccattccaacaggaataccagagg
- Show more
|
Description: A cloning plasmid for the FLRT3 gene. |
Anti-FLRT3 antibody |
STJ192077 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FLRT3 |
Recombinant Human Leucine-Rich Repeat Transmembrane Protein FLRT3/FLRT3 (C-6His) |
C970-10ug |
Novoprotein |
10ug |
EUR 156 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.2. |
Recombinant Human Leucine-Rich Repeat Transmembrane Protein FLRT3/FLRT3 (C-6His) |
C970-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.2. |
Recombinant Human Leucine-Rich Repeat Transmembrane Protein FLRT3/FLRT3 (C-6His) |
C970-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.2. |
Recombinant Human Leucine-Rich Repeat Transmembrane Protein FLRT3/FLRT3 (C-6His) |
C970-50ug |
Novoprotein |
50ug |
EUR 369 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.2. |
Human FLRT3 Antibody (Biotin Conjugate) |
32228-05121 |
AssayPro |
150 ug |
EUR 369 |
FLRT3 ORF Vector (Human) (pORF) |
ORF004119 |
ABM |
1.0 ug DNA |
EUR 95 |
Rat FLRT3 shRNA Plasmid |
20-abx990654 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FLRT3 Antibody, HRP conjugated |
1-CSB-PA882162LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FLRT3. Recognizes FLRT3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |