Human Flrt3 Elisa

Lab Reagents

Human Elisa Laboratories manufactures the human flrt3 elisa reagents distributed by Genprice. The Human Flrt3 Elisa reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Human elisa. Other Human products are available in stock. Specificity: Human Category: Flrt3 Group: Elisa

Elisa information

Human FLRT3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FLRT3 Recombinant Protein (Human)

RP012355 100 ug Ask for price

FLRT3 Polyclonal Antibody

ES10919-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FLRT3 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FLRT3 Polyclonal Antibody

ES10919-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FLRT3 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FLRT3 Polyclonal Antibody

ABP58573-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human FLRT3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FLRT3 from Human, Rat. This FLRT3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT3 protein

FLRT3 Polyclonal Antibody

ABP58573-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FLRT3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FLRT3 from Human, Rat. This FLRT3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT3 protein

FLRT3 Polyclonal Antibody

ABP58573-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FLRT3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FLRT3 from Human, Rat. This FLRT3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT3 protein

FLRT3 cloning plasmid

CSB-CL882162HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1950
  • Sequence: atgatcagcgcagcctggagcatcttcctcatcgggactaaaattgggctgttccttcaagtagcacctctatcagttatggctaaatcctgtccatctgtgtgtcgctgcgatgcgggtttcatttactgtaatgatcgctttctgacatccattccaacaggaataccagagg
  • Show more
Description: A cloning plasmid for the FLRT3 gene.

Anti-FLRT3 antibody

STJ192077 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FLRT3

Recombinant Human Leucine-Rich Repeat Transmembrane Protein FLRT3/FLRT3 (C-6His)

C970-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.2.

Recombinant Human Leucine-Rich Repeat Transmembrane Protein FLRT3/FLRT3 (C-6His)

C970-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.2.

Recombinant Human Leucine-Rich Repeat Transmembrane Protein FLRT3/FLRT3 (C-6His)

C970-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.2.

Recombinant Human Leucine-Rich Repeat Transmembrane Protein FLRT3/FLRT3 (C-6His)

C970-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.2.

Human FLRT3 Antibody (Biotin Conjugate)

32228-05121 150 ug
EUR 369

FLRT3 ORF Vector (Human) (pORF)

ORF004119 1.0 ug DNA
EUR 95

Rat FLRT3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FLRT3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FLRT3. Recognizes FLRT3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA