Cervical pedicle agenesis: case report and bibliographic review.

The posterior arch defects of the cervical backbone are uncommon, and so they come up out of deviations of the traditional intrauterine growth of the backbone (4-Eight weeks of growth). The defects vary from a cleft to the full agenesis of the posterior arch, with a reported prevalence of 4% and 0.15%, respectively.


The pedicle agenesis is most regularly present in C6. A analysis is often made after a traumatic incident in a beforehand asymptomatic affected person. 35% of a affected person’s present signs are related to instability or translation of the impaired vertebral segments like complications, persistent ache, and neurological impairment.

Neptune gentaur
Neptune gentaur


The medical and radiological findings of a affected person with an uncommon and complicated cervical backbone malformation are reported. These are uncommon entities and rarely require surgical therapy. It’s crucial for backbone surgeons to concentrate on these anatomical abnormalities to keep away from misinterpretation and thus inappropriate therapy, notably in acute trauma sufferers.


Anti-IL-8 antibody
STJ97710 200 µl
EUR 197
Description: Mouse monoclonal to IL-8.
Anti-IL-8 antibody
STJ97717 200 µl
EUR 197
Description: Mouse monoclonal to IL-8.
Anti-IL-8 antibody
STJ97720 200 µl
EUR 197
Description: Mouse monoclonal to IL-8.
Anti-IL-8 antibody
STJ98175 100 µl
EUR 234
Description: Mouse monoclonal to IL-8.
Anti-IL-8 Antibody
A2062-100 100 µg
EUR 394
1730 8 SNAP-SEAL 8 OZ
1730-8 100/pk
EUR 74
Description: Disposable Plastic; Plastic Containers
mAb mouse anti-human IL-8
CT264 0.5 mg
EUR 260
Anti-IL-8 Monoclonal Antibody
A00423-1 100ul
EUR 397
Description: Mouse Monoclonal Antibody for IL-8 Antibody (CXCL8) detection. Tested with IHC in Human, Mouse, Rat.
E5-00004 1mg
EUR 960
Swine IL-6 Recombinant Protein
R00102-8 5ug/vial
EUR 259
Description: Interleukin-6 (IL-6) is an interleukin that acts as both a pro-inflammatory and anti-inflammatory cytokine. Swine IL-6 Recombinant Protein is purified interleukin-6 produced in yeast.
Swine IL-4 Recombinant Protein
R00230-8 5ug/vial
EUR 259
Description: IL-4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation, and the differentiation of CD4+ T-cells into Th2 cells. It is a key regulator in humoral and adaptive immunity. Swine IL-4 Recombinant Protein is purified interleukin-4 produced in yeast.
Rabbit IL-2 Recombinant Protein
R00387-8 5ug/vial
EUR 259
Description: Interleukin-2 (IL-2) is a cytokine produced by T-helper cells in response to antigenic or mitogenic stimulation. It is required for T-cell proliferation and other activities crucial to the regulation of the immune response. Rabbit IL-2 Recombinant Protein is purified interleukin-2 produced in yeast.
Swine IL-17A Recombinant Protein
R00421-8 5ug/vial
EUR 259
Description: IL-17A is a member of the IL-17 family of cytokines, whose members are involved in numerous immune regulatory functions. IL-17 induces the production of many other cytokines, chemokines, and prostaglandins. Swine IL-17A Recombinant Protein is purified interleukin-17A produced in yeast.
Individual Reaction Mix 8
G065-8 200 reactions
EUR 167
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
Human Interleukin-8 (IL-8) Antibody
13102-05011 150 ug
EUR 207
Ovine IL-1 beta Recombinant Protein
R00101-8 5ug/vial
EUR 259
Description: IL-1 beta (IL-1β) is a member of the interleukin 1 family of cytokines. The IL-1 beta cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. Ovine IL-1 beta Recombinant Protein is purified interleukin-1 beta cytokine produced in yeast.
IL-8/CXCL8, Human
HY-P7224 50ug
EUR 497
Human IL-8 Protein
abx060803-25ug 25 ug
EUR 537
  • Shipped within 5-10 working days.
Human IL-8 Protein
abx060804-25ug 25 ug
EUR 537
  • Shipped within 5-10 working days.
Human IL-8 Antibody
33486-05111 150 ug
EUR 261
Recombinant Human IL-8
P0180 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P10145
Description: Recombinant Human protein for IL-8
Recombinant Human IL-8
SJB05-01 25µg/vial
EUR 285
Anti-bovine IL-8 (CXCL8) antibody
STJ15100008 250 µg
EUR 336
Description: These monoclonal antibodies enable sensitive and specific detection of bovine IL-8 in ELISpot.
Anti-bovine IL-8 (CXCL8) antibody
STJ15100009 250 µg
EUR 336
Description: This monoclonal antibody enables sensitive and specific detection of bovine IL-8 in ELISA.
IL-8 Antibody
BF0238 200ul
EUR 376
Description: IL-8 antibody detects endogenous levels of total IL-8.
E21-C97 10ug
EUR 343
GT15156 100 ug
EUR 526
IL-8 Inhibitor
H-2268.0001 1.0mg
EUR 167
Description: Sum Formula: C45H66N18O7S; CAS# [138559-60-1] net
IL-8 Inhibitor
H-2268.0005 5.0mg
EUR 576
Description: Sum Formula: C45H66N18O7S; CAS# [138559-60-1] net
IL-8 Inhibitor
H-2268.0025 25.0mg
EUR 2207
Description: Sum Formula: C45H66N18O7S; CAS# [138559-60-1] net
IL-8 Inhibitor
5-01378 4 x 5mg Ask for price
IL-8 Antibody
EUR 338
QY-E60063 96T
EUR 426
IL-8, Interleukin-8, monkey
RC222-19 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines
Human IL-8(Interleukin 8) ELISA Kit
EH0205 96T
EUR 476.25
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P10145
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml
Human Interleukin 8(IL-8)ELISA Kit
GA-E0129HM-48T 48T
EUR 289
Human Interleukin 8(IL-8)ELISA Kit
GA-E0129HM-96T 96T
EUR 466
Human Interleukin 8 (IL-8) CLIA Kit
abx195916-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Interleukin 8,IL-8 ELISA KIT
201-12-0090 96 tests
EUR 440
  • This Interleukin 8 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Interleukin 8, IL-8 ELISA KIT
CSB-E04641h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Interleukin 8, IL-8 in samples from serum, cell culture supernates, saliva, urine, cerebrospinalfluid (CSF), tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Interleukin 8, IL-8 ELISA KIT
  • EUR 500.00
  • EUR 3402.00
  • EUR 1820.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Interleukin 8, IL-8 in samples from serum, cell culture supernates, saliva, urine, cerebrospinalfluid(CSF), tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Interleukin-8 (IL-8) ELISA Kit
LF-EK60006 1×96T
EUR 790
Human Interleukin 8(IL-8)ELISA Kit
QY-E04259 96T
EUR 361
Bovine Cytokines IL-8(Cytokines IL-8) ELISA Kit
QY-E60102 96T
EUR 426
Human IL-8 ELISA Kit
EHI0063 96Tests
EUR 521
human IL-8 His tag
E410A07-100 100μg
EUR 960
EF003990 96 Tests
EUR 689
rec Endothelial IL-8 (human)
H-3742.0010 10.0µg
EUR 284
Description: Sum Formula: C397H644N114O111S4; CAS# [142298-01-9]
rec Endothelial IL-8 (human)
H-3742.0050 50.0µg
EUR 973
Description: Sum Formula: C397H644N114O111S4; CAS# [142298-01-9]
rec Monocyte IL-8 (human)
H-9625.0005 5.0µg
EUR 162
Description: Sum Formula: C372H600N106O106S4; CAS# [142298-00-8]
rec Monocyte IL-8 (human)
H-9625.0025 25.0µg
EUR 381
Description: Sum Formula: C372H600N106O106S4; CAS# [142298-00-8]
IL-8/CXCL8, 72a.a., Human
HY-P7380 50ug
EUR 497
IL-8 (Human) ELISA Kit
EUR 729
Human IL-8 ELISA kit
CT212A 5-plate
EUR 462


Bibliographic revision of Mesacanthion Filipjev, 1927 (Nematoda: Thoracostomopsidae) with description of a brand new species from Jeju Island, South Korea.

A brand new species of the genus Mesacanthion Filipjev, 1927 was found throughout a survey of pure seashores of Jeju Island in South Korea. The brand new species Mesacanthion jejuensissp. nov. shares basic morphology of the genus such because the outer labial and cephalic setae being located on the center of cephalic capsule, well-developed mandibles with two columns united by a curved bar, and three equally sized and formed tooth shorter than the mandibles.


The brand new species belongs to a gaggle of Mesacanthion species through which spicules are shorter than two anal physique diameters. The brand new species is most carefully associated to M. pannosum, first found in Puget Sound, Washington, when it comes to having enlarged cervical setae flap on the finish of cephalic capsule, spicules that are shorter than 2 anal physique diameter, each supplementary organ and gubernaculum.


It may be distinguished from M. pannosum by its stronger interior labial setae, longer outer labial setae, and distinction within the index worth of b and c’. Together with the outline of Mesacanthion jejuensissp. nov., the genus Mesacanthion Filipjev, 1927 is bibliographically reviewed and revised. Together with the brand new species, a complete of 48 species are described throughout the genus; 39 that are legitimate; eight that are thought-about to be species inquirenda as a result of misplacement of genus and poor description; one which is taken into account nomen nudum.


An up to date analysis of the genus is offered together with a compiled tabular key evaluating totally different diagnostic morphological characters of all legitimate species, in addition to a pictorial key consisting of 21 species with spicules shorter than two anal physique diameters.

Most cancers Analysis Utilizing Deep Studying: A Bibliographic Evaluate.

On this paper, we first describe the fundamentals of the sector of most cancers analysis, which incorporates steps of most cancers analysis adopted by the everyday classification strategies utilized by docs, offering a historic concept of most cancers classification methods to the readers.


These strategies embrace Asymmetry, Border, Colour and Diameter (ABCD) methodology, seven-point detection methodology, Menzies methodology, and sample evaluation. They’re used often by docs for most cancers analysis, though they don’t seem to be thought-about very environment friendly for acquiring higher efficiency. Furthermore, contemplating all varieties of viewers, the fundamental analysis standards are additionally mentioned.


The factors embrace the receiver working attribute curve (ROC curve), Space beneath the ROC curve (AUC), F1 rating, accuracy, specificity, sensitivity, precision, dice-coefficient, common accuracy, and Jaccard index. Beforehand used strategies are thought-about inefficient, asking for higher and smarter strategies for most cancers analysis. Synthetic intelligence and most cancers analysis are gaining consideration as a technique to outline higher diagnostic instruments. Specifically, deep neural networks may be efficiently used for clever picture evaluation.


The fundamental framework of how this machine studying works on medical imaging is offered on this examine, i.e., pre-processing, picture segmentation and post-processing. The second a part of this manuscript describes the totally different deep studying methods, reminiscent of convolutional neural networks (CNNs), generative adversarial fashions (GANs), deep autoencoders (DANs), restricted Boltzmann’s machine (RBM), stacked autoencoders (SAE), convolutional autoencoders (CAE), recurrent neural networks (RNNs), lengthy short-term reminiscence (LTSM), multi-scale convolutional neural community (M-CNN), multi-instance studying convolutional neural community (MIL-CNN). For every approach, we offer Python codes, to permit readers to experiment with the cited algorithms on their very own diagnostic issues.


The third a part of this manuscript compiles the efficiently utilized deep studying fashions for several types of cancers. Contemplating the size of the manuscript, we prohibit ourselves to the dialogue of breast most cancers, lung most cancers, mind most cancers, and pores and skin most cancers. The aim of this bibliographic evaluate is to supply researchers opting to work in implementing deep studying and synthetic neural networks for most cancers analysis a data from scratch of the state-of-the-art achievements.



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KIR2DL4 antibody

70R-2365 50 ug
EUR 467
Description: Rabbit polyclonal KIR2DL4 antibody raised against the middle region of KIR2DL4

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349


ELI-21303h 96 Tests
EUR 824

Human KIR2DL4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KIR2DL4 Recombinant Protein (Human)

RP017041 100 ug Ask for price

KIR2DL4 Rabbit pAb

A12836-100ul 100 ul
EUR 308

KIR2DL4 Rabbit pAb

A12836-200ul 200 ul
EUR 459

KIR2DL4 Rabbit pAb

A12836-20ul 20 ul
EUR 183

KIR2DL4 Rabbit pAb

A12836-50ul 50 ul
EUR 223

KIR2DL4 Blocking Peptide

33R-9831 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIR2DL4 antibody, catalog no. 70R-2365

KIR2DL4 Polyclonal Antibody

27806-100ul 100ul
EUR 252

KIR2DL4 Polyclonal Antibody

27806-50ul 50ul
EUR 187

KIR2DL4 cloning plasmid

CSB-CL857457HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atgtccatgtcacccacggtcatcatcctggcatgtcttgggttcttcttggaccagagtgtgtgggcacacgtgggtggtcaggacaagcccttctgctctgcctggcccagcgctgtggtgcctcaaggaggacacgtgactcttcggtgtcactatcgtcgtgggtttaaca
  • Show more
Description: A cloning plasmid for the KIR2DL4 gene.

pOTB7-KIR2DL4 Plasmid

PVTB00348 2 ug
EUR 356

KIR2DL4 ORF Vector (Human) (pORF)

ORF005681 1.0 ug DNA
EUR 95

KIR2DL4 Polyclonal Conjugated Antibody

C27806 100ul
EUR 397

pEGFP-flag-KIR2DL4 Plasmid

PVTB00348-2a 2 ug
EUR 356

KIR2DL4 sgRNA CRISPR Lentivector set (Human)

K1150301 3 x 1.0 ug
EUR 339

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

KIR2DL3 / KIR2DL1 / KIR2DL4 / KIR2DS4 Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

KIR2DL3 / KIR2DL1 / KIR2DL4 / KIR2DS4 Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.


  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4. Recognizes KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:50-1:100


  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4. Recognizes KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-10ug 10ug
EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-50ug 50ug
EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1150302 1.0 ug DNA
EUR 154

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1150303 1.0 ug DNA
EUR 154

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1150304 1.0 ug DNA
EUR 154

Recombinant Human KIR2DL4 Protein, His, Insect-1ug

QP12489-1ug 1ug
EUR 155

Recombinant Human KIR2DL4 Protein, His, Insect-50ug

QP12489-50ug 50ug
EUR 1261

Recombinant Human KIR2DL4 Protein, His, Insect-5ug

QP12489-5ug 5ug
EUR 201

KIR2DL4 Protein Vector (Human) (pPB-C-His)

PV022721 500 ng
EUR 329

KIR2DL4 Protein Vector (Human) (pPB-N-His)

PV022722 500 ng
EUR 329

KIR2DL4 Protein Vector (Human) (pPM-C-HA)

PV022723 500 ng
EUR 329

KIR2DL4 Protein Vector (Human) (pPM-C-His)

PV022724 500 ng
EUR 329

KIR2DL4 3'UTR Luciferase Stable Cell Line

TU011796 1.0 ml
EUR 1521

KIR2DL4 3'UTR GFP Stable Cell Line

TU061796 1.0 ml
EUR 1521

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1150305 3 x 1.0 ug
EUR 376

Killer Cell Immunoglobulin-Like Receptor 2DL4 (KIR2DL4) Antibody

abx145740-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1150306 1.0 ug DNA
EUR 167

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1150307 1.0 ug DNA
EUR 167

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1150308 1.0 ug DNA
EUR 167

KIR2DL4 Killer Cell Immunoglobulin-Like Receptor, 2 Domains Long Cytoplasmic Tail 4 Human Recombinant Protein

PROTQ99706 Regular: 5ug
EUR 317
Description: KIR2DL4 Human Recombinant produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 458 amino acids (24-242 a.a.) and having a molecular mass of 51kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). KIR2DL4 is expressed with a 239 amino acids hIgG-His tag at C-Terminus and purified by proprietary chromatographic techniques. 

anti-human RecQL4

AR05-PA0007 100 ul
EUR 334
Description: Rabbit polyclonal to human RecQL4

anti-human CCR1

20R-3028 200 ug
EUR 587
Description: Goat anti-human CCR1 antibody

Anti-Human IgG

DB-173-0.1 100 μl
EUR 212
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-173-0.2 200 μl
EUR 298
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-173-0.5 500 μl
EUR 384
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-173-1 1 ml
EUR 613
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-173-RTU-15 15 ml
EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB-173-RTU-7 7 ml
EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB-174-0.1 100 μl
EUR 212
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-174-0.2 200 μl
EUR 298
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-174-0.5 500 μl
EUR 384
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-174-1 1 ml
EUR 613
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-174-RTU-15 15 ml
EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB-174-RTU-7 7 ml
EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB173RTU-15 15 ml
EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB173RTU-7 7 ml
EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB174RTU-15 15 ml
EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)