Hmgb1 Mouse Elisa

Lab Reagents

Hmgb1 Elisa Laboratories manufactures the hmgb1 mouse elisa reagents distributed by Genprice. The Hmgb1 Mouse Elisa reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact hmgb1 elisa. Other Hmgb1 products are available in stock. Specificity: Hmgb1 Category: Mouse Group: Elisa

Elisa information

Goat HMGB1 ELISA Kit

EGTH0016 96Tests
EUR 521

Bovine HMGB1 ELISA Kit

EBH0016 96Tests
EUR 521

Canine HMGB1 ELISA Kit

ECH0016 96Tests
EUR 521

Chicken HMGB1 ELISA Kit

ECKH0016 96Tests
EUR 521

Anserini HMGB1 ELISA Kit

EAH0016 96Tests
EUR 521

HMGB1 ELISA KIT|Human

EF000598 96 Tests
EUR 689

Rat HMGB1 ELISA Kit

ERH0016 96Tests
EUR 521

Sheep HMGB1 ELISA Kit

ESH0016 96Tests
EUR 521

Rabbit HMGB1 ELISA Kit

ERTH0016 96Tests
EUR 521

Monkey HMGB1 ELISA Kit

EMKH0016 96Tests
EUR 521

Porcine HMGB1 ELISA Kit

EPH0016 96Tests
EUR 521

Rat HMGB1 ELISA Kit

STJ150371 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in Rat serum, plasma and other biological fluids

Human HMGB1 ELISA Kit

STJ150454 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in human serum, plasma and other biological fluids

HMGB1 protein

30R-1150 100 ug
EUR 457
Description: Purified recombinant Human HMGB1 protein

HMGB1 antibody

70R-17757 50 ul
EUR 435
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 antibody

70R-31573 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 antibody

70R-15458 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 Antibody

A1005-50
EUR 452

HMGB1 Antibody

33661-100ul 100ul
EUR 252

HMGB1 Antibody

33661-50ul 50ul
EUR 187

HMGB1 antibody

38424-100ul 100ul
EUR 252

HMGB1 antibody

10R-1114 100 ul
EUR 349
Description: Mouse monoclonal HMGB1 antibody

HMGB1 Antibody

48606-100ul 100ul
EUR 333

HMGB1 Antibody

48606-50ul 50ul
EUR 239

HMGB1 Antibody

1-CSB-PA005927
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

HMGB1 Antibody

1-CSB-PA002937
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HMGB1 Antibody

CSB-PA049959-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HMGB1 Antibody

CSB-PA049959-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HMGB1 Antibody

1-CSB-PA995991
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

HMGB1 Antibody

DF3077 200ul
EUR 304
Description: HMGB1 Antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

DF7008 200ul
EUR 304
Description: HMGB1 Antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

1-CSB-PA01604A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

HMGB1 Antibody

1-CSB-PA225274
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

Bovine HMGB1

9050 1 mg/ml x 0.1 ml
EUR 309.55
Description: Bovine HMGB1

HMGB1 Protein

20-abx260452
  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

HMGB1 Antibody

AF7020 200ul
EUR 376
Description: HMGB1 antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

1-CSB-PA010553GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HMGB1 Antibody

1-CSB-PA010553YA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

HMGB1 Protein

20-abx600027
  • EUR 1887.00
  • EUR 1261.00
  • EUR 1372.00
  • EUR 968.00
  • 1 mg
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1-2 months.

HMGB1 siRNA

20-abx902481
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMGB1 siRNA

20-abx919601
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMGB1 siRNA

20-abx919602
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMGB1 antibody

ABF7020 100 ug
EUR 438

HMGB1 Antibody

ABD3077 100 ug
EUR 438

HMGB1 Antibody

ABD7008 100 ug
EUR 438

pENTR223- HMGB1

PVT10093 2 ug
EUR 266

HMGB1 Plasmid

PVT7114 2 ug
EUR 266

anti-HMGB1

YF-PA12378 100 ul
EUR 403
Description: Rabbit polyclonal to HMGB1

anti-HMGB1

YF-PA23886 50 ul
EUR 334
Description: Mouse polyclonal to HMGB1

HMGB1, human

RC712-17 50ug
EUR 169.63
  • Product category: Proteins/Recombinant Proteins/Other

Hmgb1 ORF Vector (Mouse) (pORF)

ORF047290 1.0 ug DNA
EUR 506

Guinea Pig HMGB1 ELISA Kit

EGH0016 96Tests
EUR 521

HMGB1 ELISA Kit (Rat) (OKAN06040)

OKAN06040 96 Wells
EUR 792
Description: Description of target: heparin binding protein that facilitates neurite outgrowth [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

HMGB1 ELISA Kit (Human) (OKAN06342)

OKAN06342 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28.3 pg/mL

HMGB1 ELISA Kit (Human) (OKAN06343)

OKAN06343 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 22.5 pg/mL

HMGB1 ELISA Kit (Dog) (OKCA02054)

OKCA02054 96 Wells
EUR 917
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance. Has proangiogenic activity. May be involved in platelet activation. Binds to phosphatidylserine and phosphatidylethanolamide. Bound to RAGE mediates signaling for neuronal outgrowth. May play a role in accumulation of expanded polyglutamine (polyQ) proteins.;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

HMGB1 ELISA Kit (Rat) (OKCD04073)

OKCD04073 96 Wells
EUR 818
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

HMGB1 ELISA Kit (Human) (OKCD04074)

OKCD04074 96 Wells
EUR 753
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28.3 pg/mL

HMGB1 ELISA Kit (Pig) (OKEH07385)

OKEH07385 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059ng/mL

HMGB1 ELISA Kit (Rabbit) (OKWB00408)

OKWB00408 96 Wells
EUR 572
Description: Description of target: ;Species reactivity: Rabbit;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.375 ng/mL

HMGB1 ELISA Kit (Chicken) (OKEH03961)

OKEH03961 96 Wells
EUR 844
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. Nuclear functions are attributed to fully reduced HGMB1. Associates with chromatin and binds DNA with a preference to non-canonical DNA structures such as single-stranded DNA, DNA-containing cruciforms or bent structures, supercoiled DNA and ZDNA. Can bent DNA and enhance DNA flexibility by looping thus providing a mechanism to promote activities on various gene promoters. Can restructure the canonical nucleosome. Proposed to be an universal biosensor for nucleic acids. May promote inflammatory response to sterile and infectious signals and may be involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm may function as sensor and/or chaperone for immunogenic nucleic acids, and mediate autophagy. May act as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.062 ng/mL

HMGB1 Rabbit pAb

A0718-100ul 100 ul
EUR 308

HMGB1 Rabbit pAb

A0718-200ul 200 ul
EUR 459

HMGB1 Rabbit pAb

A0718-20ul 20 ul Ask for price

HMGB1 Rabbit pAb

A0718-50ul 50 ul Ask for price

HMGB1 Detection Kit

6010 1 kit
EUR 753.25
Description: HMGB1 Detection Kit

HMGB1 antibody (HRP)

60R-2188 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (HRP)

HMGB1 antibody (FITC)

60R-2189 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (FITC)

HMGB1 antibody (biotin)

60R-2190 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (biotin)

HMGB1 Blocking Peptide

DF3077-BP 1mg
EUR 195

HMGB1 Blocking Peptide

DF7008-BP 1mg
EUR 195

HMGB1 Polyclonal Antibody

A-2700 100 µl
EUR 724.25
Description: The best epigenetics products

Anti-HMGB1 Antibody

A00066-1 100ug/vial
EUR 334

HMGB1 (AcK12) Antibody

20-abx141151
  • EUR 384.00
  • EUR 606.00
  • EUR 230.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

HMGB1 Blocking Peptide

20-abx061647
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HMGB1 Blocking Peptide

20-abx061850
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HMGB1/HMG-1

E21-357 10ug
EUR 343

HMGB1 Conjugated Antibody

C48606 100ul
EUR 397

HMGB1 Blocking Peptide

AF7020-BP 1mg
EUR 195

HMGB1 Conjugated Antibody

C33661 100ul
EUR 397

HMGB1 cloning plasmid

CSB-CL010553HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.

HMGB1 cloning plasmid

CSB-CL010553HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.

HMGB1 Polyclonal Antibody

A51497 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- HMGB1 antibody

FNab10218 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: High mobility group protein B1
  • Uniprot ID: P09429
  • Gene ID: 3146
Description: Antibody raised against HMGB1

anti- HMGB1 antibody

FNab03924 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: high-mobility group box 1
  • Uniprot ID: P09429
  • Gene ID: 3146
  • Research Area: Neuroscience, Signal Transduction, Metabolism, Epigenetics
Description: Antibody raised against HMGB1

Anti-HMGB1 antibody

PAab03924 100 ug
EUR 355

Recombinant Human HMGB1

P0194 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09429
Description: Recombinant Human protein for HMGB1

pShuttle- CMV- HMGB1

PVT10158 2 ug
EUR 301

pcDNA3.1(+)-HMGB1 Plasmid

PVTB50051-2a 2 ug
EUR 356

pCMV-SPORT6-HMGB1

PVT18174 2 ug
EUR 231

pET28a-HMGB1 Plasmid

PVTB00031-1a 2 ug
EUR 356

Anti-HMGB1 antibody

STJ24037 100 µl
EUR 277
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 antibody

STJ24039 100 µl
EUR 413
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 antibody

STJ29816 100 µl
EUR 457
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 Antibody

STJ501358 100 µg
EUR 476

Anti-HMGB1 (1D5)

YF-MA10425 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1B11)

YF-MA10426 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (2F6)

YF-MA10427 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1B2)

YF-MA13482 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1D10)

YF-MA13483 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1D9)

YF-MA13484 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Human CellExp? HMGB1 /HMG1, Mouse Recombinant

P1465-10
EUR 185

Human CellExp? HMGB1 /HMG1, Mouse Recombinant

P1465-50
EUR 490

HMGB1 ELISA Kit (Pig | Swine) (OKCA02201)

OKCA02201 96 Wells
EUR 917
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance. Has proangiogenic activity. May be involved in platelet activation. Binds to phosphatidylserine and phosphatidylethanolamide. Bound to RAGE mediates signaling for neuronal outgrowth. May play a role in accumulation of expanded polyglutamine (polyQ) proteins.;Species reactivity: Pig | Swine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL.

Mouse Hmgb1/ High mobility group protein B1 ELISA Kit

E0678Mo 1 Kit
EUR 571

Mouse High Mobility Group Protein B1 (HMGB1) ELISA Kit

20-abx154148
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse High Mobility Group Protein B1 (HMGB1) ELISA Kit

abx254738-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse High mobility group protein B1, HMGB1 ELISA Kit

ELA-E0399m 96 Tests
EUR 865

Mouse Hmgb1(High mobility group protein B1) ELISA Kit

EM0382 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: P63158
  • Alias: Hmgb1/HMG-1/Amphoterin/high mobility group box 1/High mobility group protein 1/high-mobility group(nonhistone chromosomal) protein 1/high-mobility group box 1/HMG-1/HMG1DKFZp686A04236/HMG3/
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

Acetyl-HMGB1 (K12) Antibody

1-CSB-PA000149
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-HMGB1 (K12). Recognizes Acetyl-HMGB1 (K12) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

HMGB1 Antibody, HRP conjugated

1-CSB-PA01604B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HMGB1 Antibody, FITC conjugated

1-CSB-PA01604C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HMGB1 Antibody, Biotin conjugated

1-CSB-PA01604D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HMGB1 (AcK12) Blocking Peptide

20-abx061849
  • EUR 300.00
  • EUR 495.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Rat HMGB1 shRNA Plasmid

20-abx985044
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HMGB1 Antibody, HRP conjugated

1-CSB-PA010553YB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HMGB1 Antibody, FITC conjugated

1-CSB-PA010553YC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HMGB1 Antibody, Biotin conjugated

1-CSB-PA010553YD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human HMGB1 shRNA Plasmid

20-abx952147
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HMGB1 recombinant monoclonal antibody

A5052 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human HMGB1 for WB, IF,ELISA

pCMV-HA-HMGB1 Plasmid

PVTB00732-2a 2 ug
EUR 356

pECMV-3-FLAG-HMGB1

PVT12760 2 ug
EUR 703

Recombinant Human HMGB1 Protein

RP00010 5 μg
EUR 136

HMGB1 Recombinant Protein (Human)

RP014974 100 ug Ask for price

HMGB1 Recombinant Protein (Human)

RP014977 100 ug Ask for price

HMGB1 Recombinant Protein (Rat)

RP204722 100 ug Ask for price

Antibody for Human HMGB1

SPC-1259D 0.1ml
EUR 314
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is unconjugated.

Antibody for Human HMGB1

SPC-1259D-A390 0.1ml
EUR 361
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 390.

Antibody for Human HMGB1

SPC-1259D-A488 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 488.

Antibody for Human HMGB1

SPC-1259D-A565 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 565.

Antibody for Human HMGB1

SPC-1259D-A594 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 594.

Antibody for Human HMGB1

SPC-1259D-A633 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 633.

Antibody for Human HMGB1

SPC-1259D-A655 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 655.

Antibody for Human HMGB1

SPC-1259D-A680 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 680.

Antibody for Human HMGB1

SPC-1259D-A700 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 700.

Antibody for Human HMGB1

SPC-1259D-ALP 0.1ml
EUR 355
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human HMGB1

SPC-1259D-APC 0.1ml
EUR 359
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to APC .

Antibody for Human HMGB1

SPC-1259D-APCCY7 0.1ml
EUR 432
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to APC/Cy7.

Antibody for Human HMGB1

SPC-1259D-BI 0.1ml
EUR 357
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Biotin.

Antibody for Human HMGB1

SPC-1259D-DY350 0.1ml
EUR 436
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 350.

Antibody for Human HMGB1

SPC-1259D-DY405 0.1ml
EUR 412
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 405.

Antibody for Human HMGB1

SPC-1259D-DY488 0.1ml
EUR 393
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 488.

Antibody for Human HMGB1

SPC-1259D-DY594 0.1ml
EUR 397
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 594.

Antibody for Human HMGB1

SPC-1259D-DY633 0.1ml
EUR 387
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 633.

Antibody for Human HMGB1

SPC-1259D-FITC 0.1ml
EUR 353
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to FITC.

Antibody for Human HMGB1

SPC-1259D-HRP 0.1ml
EUR 349
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to HRP.

Antibody for Human HMGB1

SPC-1259D-P594 0.1ml
EUR 367
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to PE/ATTO 594.

Antibody for Human HMGB1

SPC-1259D-PCP 0.1ml
EUR 359
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to PerCP.

Antibody for Human HMGB1

SPC-1259D-RPE 0.1ml
EUR 358
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to RPE .

Antibody for Human HMGB1

SPC-1259D-STR 0.1ml
EUR 359
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Streptavidin.

Anti-HMGB1 Antibody (Biotin)

STJ501359 100 µg
EUR 586

Anti-HMGB1 Antibody (FITC)

STJ501360 100 µg
EUR 586

Anti-HMGB1 (1E6-E10)

YF-MA10424 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

HMGB1 Protein Vector (Mouse) (pPB-C-His)

PV189158 500 ng
EUR 603

HMGB1 Protein Vector (Mouse) (pPB-N-His)

PV189159 500 ng
EUR 603

HMGB1 Protein Vector (Mouse) (pPM-C-HA)

PV189160 500 ng
EUR 603

HMGB1 Protein Vector (Mouse) (pPM-C-His)

PV189161 500 ng
EUR 603

Hmgb1 ELISA Kit| Mouse High mobility group protein B1 ELISA Kit

EF013044 96 Tests
EUR 689

HMGB1 Chemi-Luminescent ELISA Kit (Human) (OKCD03560)

OKCD03560 96 Wells
EUR 988
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury . Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance . Has proangiogdenic activity . May be involved in platelet activation . Binds to phosphatidylserine and phosphatidylethanolamide . Bound to RAGE mediates signaling for neuronal outgrowth . May play a role in accumulation of expanded polyglutamine (polyQ) proteins such as huntingtin (HTT) or TBP .;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 13.7 pg/mL

Anti-Bovine HMGB1 IgG Antibodies

7028 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-Bovine HMGB1 IgG Antibodies

Anti-Bovine HMGB1 IgY Antibodies

7064 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-Bovine HMGB1 IgY Antibodies

[KO Validated] HMGB1 Rabbit pAb

A0719-100ul 100 ul
EUR 459

[KO Validated] HMGB1 Rabbit pAb

A0719-200ul 200 ul
EUR 686

[KO Validated] HMGB1 Rabbit pAb

A0719-20ul 20 ul
EUR 221

[KO Validated] HMGB1 Rabbit pAb

A0719-50ul 50 ul
EUR 308

HMGB1 Polyclonal Antibody, HRP Conjugated

A51498 100 µg
EUR 570.55
Description: fast delivery possible

HMGB1 Polyclonal Antibody, FITC Conjugated

A51499 100 µg
EUR 570.55
Description: reagents widely cited

HMGB1 Polyclonal Antibody, Biotin Conjugated

A51500 100 µg
EUR 570.55
Description: Ask the seller for details

[KO Validated] HMGB1 Rabbit mAb

A19529-100ul 100 ul
EUR 410

[KO Validated] HMGB1 Rabbit mAb

A19529-200ul 200 ul
EUR 571

[KO Validated] HMGB1 Rabbit mAb

A19529-20ul 20 ul
EUR 221

[KO Validated] HMGB1 Rabbit mAb

A19529-50ul 50 ul
EUR 287

[KO Validated] HMGB1 Rabbit pAb

A2553-100ul 100 ul
EUR 410

[KO Validated] HMGB1 Rabbit pAb

A2553-200ul 200 ul
EUR 571

[KO Validated] HMGB1 Rabbit pAb

A2553-20ul 20 ul
EUR 221

[KO Validated] HMGB1 Rabbit pAb

A2553-50ul 50 ul
EUR 287

Anti-HMGB1 Antibody (monoclonal, 5H3)

M00066-2 100ug/vial
EUR 334

Hmgb1 ORF Vector (Rat) (pORF)

ORF068242 1.0 ug DNA
EUR 506

HMGB1 ORF Vector (Human) (pORF)

ORF004992 1.0 ug DNA
EUR 95

HMGB1 ORF Vector (Human) (pORF)

ORF004993 1.0 ug DNA
EUR 95

pECMV- 3*Flag- HMGB1- m

PVT10464 2 ug
EUR 301

[One Step] HMGB1 antibody Kit

RK05718 50 ul
EUR 240

Anti-HMGB1 (KO Validated) Antibody

A2127-100 100 µl
EUR 399

Anti-HMGB1 Peptide (2-11) Antibodies

7029 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-HMGB1 Peptide (2-11) Antibodies

Anti-HMGB1 Peptide (166-176) Antibodies

7030 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-HMGB1 Peptide (166-176) Antibodies

Human CellExp? HMGB1 /HMG1, human recombinant

7240-10
EUR 229

Human CellExp? HMGB1 /HMG1, human recombinant

7240-50
EUR 582

pGEX-4T-1-HMGB1(FL) Plasmid

PVTB00031-1b 2 ug
EUR 356

Chicken HMGB1/ High mobility group protein B1 ELISA Kit

E0034Ch 1 Kit
EUR 717